Publications

Conservation biologists face many challenges in assessing health, immune status and infectious diseases in protected species. These challenges include unpredictable sample populations, diverse genetic and environmental backgrounds of the animals, as well as the practical, legal and ethical issues involved in experimentation. The use of whole genome scale transcriptomics with animal samples obtained in a minimally invasive manner is an approach that shows promise for health assessment. In this study we assessed the utility of a microarray to identify changes in gene expression predictive of health status by interrogating blood samples from California sea lions (Zalophus californianus) in rehabilitation. A custom microarray was developed from the commercially available dog microarray (Canis familiaris) by selecting probes that demonstrated reliable cross-hybridization with RNA in sea lion blood. This custom microarray was used for the analysis of RNA from 73 sea lion blood samples, from animals with a broad spectrum of health changes. Both traditional classifying techniques and newer artificial neural network approaches correctly classified sea lions with respect to health status, primarily distinguishing between leptospirosis infection and domoic acid exposure. Real time PCR validation for a small set of genes, followed by sequencing, showed good correlation with array results and high identity (96-98%) between the dog and sea lion sequences. This approach to health status classification shows promise for disease identification in a clinical setting, and assessment of health status of wildlife.

Despite the development of potentially curative chemotherapy, tuberculosis (TB) continues to cause increasing worldwide morbidity and is a leading cause of human mortality in the developing world. Recent advances in bacterial molecular genetics, immunology, and human genetics have yielded insight into the molecular determinants of virulence, the immune responses that are essential for restricting progressive disease, and the determinants of immunopathology in TB. Despite these advances, a large knowledge gap still exists that limits the development and testing of new interventions, including novel drugs and efficacious vaccines. This review focuses on our current knowledge of TB pathogenesis and immunity that has been derived from in vitro and in vivo studies. In addition, it highlights topics that need to be better understood to provide improved means of controlling TB worldwide.

Cancer is driven by complex genetic and cellular mechanisms. Recently, the Drosophila community has become increasingly interested in exploring cancer issues. The Drosophila field has made seminal contributions to many of the mechanisms that are fundamental to the cancer process; several of these mechanisms have already been validated in vertebrates. Less well known are the Drosophila field's early direct contributions to the cancer field: some of the earliest tumor suppressors were identified in flies. In this review, we identify major contributions that Drosophila studies have made toward dissecting the pathways and mechanisms underlying tumor progression. We also highlight areas, such as drug discovery, where we expect Drosophila studies to make a major scientific impact in the future.

Most uncomplicated urinary tract infections (UTIs) are caused by uropathogenic Escherichia coli (UPEC). Both motility and adherence are integral to UTI pathogenesis, yet they represent opposing forces. Therefore, it is logical to reciprocally regulate these functions. In UPEC strain CFT073, PapX, a non-structural protein encoded by one of the two pap operons encoding P fimbria adherence factor, represses flagella-mediated motility and is a putative member of the winged helix transcription factor family. The mechanism of this repression, however, is not understood. papX is found preferentially in more virulent UPEC isolates, being significantly more prevalent in pyelonephritis strains (53% of isolates) than in asymptomatic bacteriuria (32%) or fecal/commensal (12.5%) strains. To examine PapX structure-function, we generated papX linker insertion and site-directed mutants, which identified two key residues for PapX function (Lys(54) and Arg(127)) within domains predicted by modeling with I-TASSER software to be important for dimerization and DNA binding, respectively. To determine the PapX binding site in the CFT073 genome, systematic evolution of ligands by exponential enrichment (SELEX) in conjunction with high throughput sequencing was utilized for the first time to determine a novel binding site for a bacterial transcription factor. This method identified a 29-bp binding site within the flhDC promoter (TTACGGTGAGTTATTTTAACTGTGCGCAA), centered 410 bp upstream of the flhD translational start site. Gel shift experiments demonstrated that PapX binds directly to this site to repress transcription of flagellar genes.